Sap-ilmik

Vikipedi, özgür ansiklopedi
Atla: kullan, ara
Bir RNA sap-ilmik örneği

Sap-ilmik molekül içi baz eşleşmesi, tek iplikli DNA'da ve, daha yaygın olarak, RNA'da görülen bir yapıdır. Firkete veya firkete ilmiği olarak da adlandırılır. Bu yapı, aynı molekülün nükleotit dizisi bakımından genelde palindromik olan iki bölgesi arasında baz eşleşmesi sonucu meydana gelen çifte sarmal ve bu sarmalın ucunda eşleşmemiş bir ilmikten oluşur. Palindromik bir dizi her iki yönde de aynı okunan bir dizidir, örneğin bir yönde AAGC olan bir dizi, ters yönde TTCG olarak okunur, bu diziler birbirlerine komplemanter oldukları için DNA dizisi olarak palindromik oldukları söylenir. Meydana gelen lolipop benzeri yapı pek çok RNA ikincil yapısının yapı taşıdır.

Oluşum ve kararlılık[değiştir | kaynağı değiştir]

Bir sap-ilmik yapısının oluşumu meydana gelecek sarmal ve ilmik bölgelerinin kararlılığına bağlıdır. Tabii ki, birinci ön şart kendi üzerine katlanarak bir çift sarmal oluşturabilecek bir dizinin var olmasıdır. Bu sarmalın kararlılığını belirleyen faktörler onun uzunluğu, içindeki birbiriyle uyumsuz baz sayısı veya bel verme (İng. bulge) sayıları (uzun bir sarmalda bunlardan az sayıda olmasına tolerans vardır) ve eşleşmiş bölgenin baz bileşimidir. Guanin ve sitozin bazları arasındaki eşleşmeler üçer hidrojen bağından oluşur ve bu yüzden iki hidrojen bağı olan adenin-timin eşleşmelerinden daha kararlıdır. RNA'da adenin-urasil eşleşmeleri yaygındır ve ikincil yapı oluşumuna ktkida bulunurlar. Bazların aromatik halkalarındaki pi orbitallerini uygun bir doğrultuda bir hizaya getiren istiflenme etkileşimleri de sarmal oluşumuna önayak olur.

İlmiğin kararlılığı da sap-ilmik yapılarının oluşumuna etki eder. Üç bazdan kısa olan "ilmikler" sterik olarak olanaksızdır ve meydana gelmezler. Kendi ikincil yapısı (sahte düğüm eşleşmesi gibi) olmayan büyük ilmikler de kararsızdır. En iyi ilmik uzunluğu 4-8 baz uzunluğunda olur. UUCG dizisi içeren yaygın bir ilmik "dörtlü ilmik" (İng. "tetraloop") olarak adlandırılır ve kendisini oluşturan nükleotitler arasındaki baz istiflenme etkileşimleri nedeniyle özellikle kararlıdır.

Yapısal bağlamlar[değiştir | kaynağı değiştir]

Sap-ilmikler pre-mikroRNA yapılarında ve taşıyıcı RNA'da görülür. tRNA'da üç gerçek sap-ilmik ve bir sap bir yonca şeklinde bir araya gelirler. Translasyon sırasında kodonu tanıyan antikodon, tRNA'daki ilmiklerden birinde bulunur. RNA sahte düğümlerinde (İng. pseudoknot) iki iç içe sap-ilmik yapısı bulunur, bunlardan birinin ilmiği ikincinin sapını meydana getirir.

Çoğu ribozim de sap-ilmik yapılar içerir. Kendi kendini kesen çekiçbaşı ribozimi üç sap-ilmik içerir, bunlar kesilmenin gerçekleştiği, eşleşmemiş merkezi bir bölgede birleşirler. Çekiçbaşı ribozimin bu temel ikincil yapısı onun öz-kesim etkinliği için gereklidir.

Sap-ilmik yapılar prokaryotlara has olan ro'dan bağımsız transkripsiyon sonlanmasında da önemlidir. Mesajcı RNA'da meydana gelen bir sap-ilmik RNA polimerazın transkripsiyon sırasında DNA'nın kalıp ipliğinden ayrışmasına neden olur. Bu süreç ro'dan bağımsız veya içsel (intrinsic) sonlanma olarak adlandırılır, bunun olmasına neden olan diziler de sonlanma dizisi olarak adlandırılır.

Örnekler[değiştir | kaynağı değiştir]

Bu palindromik DNA dizisi,

---CCTGCXXXXXXXGCAGG---

aşağıdaki sap-ilmik yapısını oluşturabilir:

---C G---
   C G
   T A
   G C
   C G
   X X
  X   X
   X X
    X

Sap-ilmik yapısı oluşturacak daha uzun bir RNA dizisine örnek:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC

Ayrıca bakınız[değiştir | kaynağı değiştir]

Kaynakça[değiştir | kaynağı değiştir]

  • Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. 6. bölüm.