DNA dizisi

Vikipedi, özgür ansiklopedi
Atla: kullan, ara
Bir otomatik dizileme aracının çıktısından okunabilen DNA dizisi

DNA dizisi veya genetik dizi, gerçek veya hayalî bir DNA] molekülü veya ipliğinin birincil yapısına karşılık gelen harfler dizisidir.

Bu dizide bulunan harfler A, C, G, ve T 'dir, bunlar DNA ipliğinde bulunan adenin, sitozin, guanin, ve timin adlı dört bazı temsil eder. Tipik olarak bu diziyi oluşturan harfler birbirine bitişik olarak, aralarda boşluk olmaksızın yazılır, örneğin AAAGTCTGAC gibi; bu dizinin soldan sağa okunuşu 5'-3' doğrultusuna karşılık gelir.

Fonksiyona göre bir DNA dizisine anlamlı veya anti-anlamlı ve kodlayan veya kodlamayan olarak değinilebilir.

Bir DNA molekülünün baz dizisinin okunmasına DNA dizilemesi denir.

Belirsizlik sembolleri[değiştir | kaynağı değiştir]

Özel durumlarda bir dizide A, T, C ve G dışında harfler bulunabilir. Bu harfler dizide belirsizlik olduğunu belirtmek için kullanılır. Saf ve Uygulamalı Kimya Uluslararası Birliği (IUPAC)'nin bu amaç için belirlemiş olduğu sembollerin anlamları (ve anımsatıcıları) şöyledir:[1]

  • A = adenin
  • C = sitozin (ing. cytosine)
  • G = guanin
  • T = timin
  • U = uridin (RNA dizilerinde kullanılır)
  • R = G A (pürin)
  • Y = T C (pirimidin: ing. pyrimidine)
  • K = G T (keto gruplular)
  • M = A C (amino gruplular)
  • S = G C (kuvvetli bağlılar: ing. strong bonds)
  • W = A T (zayıf bağlılar: ing. weak bonds)
  • B = G T C (A harici hepsi)
  • D = G A T (C harici hepsi)
  • H = A C T (G harici hepsi)
  • V = G C A (T harici hepsi)
  • N = A G C T (herhangi)

Yukarıda belirtilen belirsizlik sembolleri başlıca iki durumda kullanılır:

  • DNA dizilemesi sırasında bir baz teknik nedenlerden dolayı tam okunamadığı zaman (örneğin ya G ya C olabilirse, 'S' yazılır)
  • birbirine benzeşen dizilerin ortak yönlerini belirtmek için. Örneğin SREBP adlı transkripsiyon faktörünün bağlandığı dizilerin ortak özelliği TCACNCCAC olarak yazılabilir. Bu örnekteki N harfi o konumda herhangi bir bazın bulunabileceği anlamına gelir. Bir diziler grubununu bu şekilde ifade edilen biçimine dizi motifi denir.

Dizi formatları[değiştir | kaynağı değiştir]

DNA dizilerinin biyoenformatik programları tarafından okunması için belli standart formatlar oluşmuştur. Örneğin bunların en yaygını olan FASTA formatında birinci satır bir ">" sembolünü takibeden bir başlık içerir, onu izleyen satırlarda ise DNA dizisi yer alır.[2] Örneğin:

>gi|14456711|ref|NM_000558.3| Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA
ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC
AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC
TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG
CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG
TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT
GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA
GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTT
CTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA
AGTCTGAGTGGGCGGC

Ayrıca bakınız[değiştir | kaynağı değiştir]

Kaynakça[değiştir | kaynağı değiştir]